He’ll destroy Noctis chest and there will be nothing he could do about it.
RIP Noctis and his tits.
This tumblr situation is basically like those dickheads in school that won’t fess up after doing some stupid shit and now the whole class has to suffer the consequences
So tumblr has an “export” feature these days. Main menu [little person icon] -> Settings -> click on blog -> “Export” button near bottom of page.
It takes a surprisingly long time for blogs with a few hundred posts.
Anyone seen it complete, at all, ever, for a blog with significantly more posts? Say, >40k?
I tried it twice, it took an entire afternoon (I have less than 20k posts on here) and in the end the zip file was broken both times and didn’t unzip. I’d suggest the Python option https://github.com/bbolli/tumblr-utils/blob/master/tumblr_backup_for_beginners.md
It was insanely fast in comparison and worked as intended.
interesting. i have done a couple of under-1k-post blogs, they seem okay, my main blog is somewhere well over 4GB, and i would expect it to be broken because zip doesn’t necessarily handle that well.
My blogs with under 2000 posts seem to finish processing in a few hours, and become downloadable. However, around the 2000 post point, even if the blog finishes processing, the download doesn’t actually work. It downloads half or a quarter or some fraction of the zip, and breaks.I really strongly suggest using the tumblr_backup.py script, from here: https://github.com/bbolli/tumblr-utils/blob/master/tumblr_backup_for_beginners.md
we’re going to have to call smut ‘lemons’ again, aren’t we?
LEMONS!? WHEN THE FUCK WAS THIS?!
oh you sweet summer child
goddamn how long have i been on here that kids these days don’t know wtf lemons is
Incase anything happens to my account here’s my entire genome:
GATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGYTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTAOCGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHUATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTCKAATCAATCCTCHATCTNACCCCCTTTAFCOGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTAFCGATCCCGTAGWGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTGATTTACTCGTACGGTACGATCCCGTAGGGTAGGGGGTTAAGGCTCTGIAGGGTTCCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGHCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATTACGGTACGATCCCGTAGGGTAGGGGGTTAATTGGCTCTGAGGGTTCTYCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCGATCCACGTAGGGTAGGGGGTTAAGGCTCTGAGGGAATTCCAATCAATCCTCAATCATCAATCAACTDCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCTTCCTTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATOCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCHATCTACCCCCTTTAFCGATCCCGDTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGCATCTACCCCCTTTAFOCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCTCAATCCTTTAFCGATCCCGTAGGGTIAGGATCCTCATCTACCTCTTCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTTCCAATCAOATCCTCTCAATCCTCAATCAATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGHGCCTCAATCATCAATCCETCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGGATCCTCATCTACCCCCTTTAFCGATCCCGTAGGGTAGGGGGTTAAGGCTCTGAGGGTMTCCAATCAATCCTCTCAATCCTCAATCAATCCTCHATCTACCCCCTTTAFCGATCCCGTAGGGTAGG…
They doing everything they can to try to discredit the protest
Because this is what it takes to force people to think about things they do not want to…
THESE TITS are now illegal on tumblr folks
these fat bags are BANNED
my fuking boobies are outlaws dude, some bad milk jugs smh

@crossedquills Something I had in mind from your last fic :>
Omg! Well I guess that answers Gladio’s question “what the hell is a knot?”





